zgc:85683

Ensembl ID:
ENSDARG00000020169
ZFIN ID:
ZDB-GENE-040426-2499
Description:
fumarylacetoacetate hydrolase domain containing 2A [Source:RefSeq peptide;Acc:NP_998083]
Human Orthologues:
FAHD2A, FAHD2B
Human Descriptions:
fumarylacetoacetate hydrolase domain containing 2A [Source:HGNC Symbol;Acc:24252]
fumarylacetoacetate hydrolase domain containing 2B [Source:HGNC Symbol;Acc:25318]
Mouse Orthologue:
Fahd2a
Mouse Description:
fumarylacetoacetate hydrolase domain containing 2A Gene [Source:MGI Symbol;Acc:MGI:1915376]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41271 Nonsense Mutation detected in F1 DNA During 2018
sa16545 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41271
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017576 Nonsense 218 291 6 8
ENSDART00000136385 Nonsense 163 236 4 6
Genomic Location (Zv9):
Chromosome 8 (position 43214637)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 41160624
GRCz11 8 41194596
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTTGTTAAACAGATGTTCATAAGCTGGGCATTCGCTGTTTCGTGAAC[G/T]GAGCCACAGTTCAGGAAAGCAACACCAATCAAATGATCTTCCAGACGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16545
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017576 Nonsense 272 291 8 8
ENSDART00000136385 Nonsense 217 236 6 6
Genomic Location (Zv9):
Chromosome 8 (position 43206629)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 41152616
GRCz11 8 41186588
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTGTATTGTATAATTGTATAATGAAGTGATTTTAACRATGTTTTTCAG[A/T]AAGGAGATGTCGTGGAGTGTCAGATTGATGAGATCGGATCGATACGCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link