spag6

Ensembl ID:
ENSDARG00000020158
ZFIN ID:
ZDB-GENE-040704-53
Description:
sperm-associated antigen 6 [Source:RefSeq peptide;Acc:NP_001002210]
Human Orthologue:
SPAG6
Human Description:
sperm associated antigen 6 [Source:HGNC Symbol;Acc:11215]
Mouse Orthologues:
BC061194, Spag6
Mouse Descriptions:
cDNA sequence BC061194 Gene [Source:MGI Symbol;Acc:MGI:3040687]
sperm associated antigen 6 Gene [Source:MGI Symbol;Acc:MGI:1354388]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6762 Splice Site, Nonsense Mutation detected in F1 DNA During 2018
sa13900 Splice Site, Nonsense Available for shipment Available now
sa31100 Nonsense Mutation detected in F1 DNA During 2018
sa44115 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6762
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017605 Splice Site, Nonsense 97 507 4 11
Genomic Location (Zv9):
Chromosome 24 (position 17822532)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 17129008
GRCz11 24 17273427
KASP Assay ID:
554-5357.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGATTGCTTTGTCCATTCCCCTATGAATAYATGGGATATGAAAGACAG[C/T]GATTCTATAAGAARGCTGCTGCATTCGTTCTTCGGGCTRTTGCTAAGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13900
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017605 Splice Site, Nonsense 226 507 5 11
Genomic Location (Zv9):
Chromosome 24 (position 17823000)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 17129476
GRCz11 24 17273895
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCAATCGCACACCTTGCACAGATGATCCTAAACCCAGATGCCAAATTG[A/T]AGGTCACAAAGCCTACAGATATTATAATCAATGACTCGCAAAGGGATAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31100
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017605 Nonsense 481 507 10 11
ENSDART00000017605 Nonsense 481 507 10 11
Genomic Location (Zv9):
Chromosome 24 (position 17825573)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 17132049
GRCz11 24 17276468
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACCTGGTTCTGCAATTCAGGAATATATTAATGCAATCAACAACTGTTA[C/A]CCTGAAGAGATTGTCAGGTACATGCACATTTATATGCATAATAAAAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44115
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017605 Nonsense 481 507 10 11
ENSDART00000017605 Nonsense 481 507 10 11
Genomic Location (Zv9):
Chromosome 24 (position 17825573)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 17132049
GRCz11 24 17276468
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACCTGGTTCTGCAATTCAGGAATATATTAATGCAATCAACAACTGTTA[C/A]CCTGAAGAGATTGTCAGGTACATGCACATTTATATGCATAATAAAAAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link