zgc:73340

Ensembl ID:
ENSDARG00000020145
ZFIN ID:
ZDB-GENE-030131-4851
Description:
hypothetical protein LOC326652 [Source:RefSeq peptide;Acc:NP_956037]
Human Orthologue:
C8orf79
Human Description:
chromosome 8 open reading frame 79 [Source:HGNC Symbol;Acc:26725]
Mouse Orthologue:
6430573F11Rik
Mouse Description:
RIKEN cDNA 6430573F11 gene Gene [Source:MGI Symbol;Acc:MGI:2442328]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa816 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa816
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005897 Essential Splice Site 110 412 4 4
ENSDART00000139630   None 121 None 4

The following transcripts of ENSDARG00000020145 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 32167740)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 33848807
GRCz11 15 33706786
KASP Assay ID:
554-0720.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACTATAAYACATCAATGACCTATCAATACAATCTCTTTTAATTRCCCA[G/A]TCATCCAYCACATGTCCACCAAAGAGCGGCGTATCCGAGCAATAAAAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link