zgc:92578

Ensembl ID:
ENSDARG00000020123
ZFIN ID:
ZDB-GENE-040718-487
Description:
Chaperone activity of bc1 complex-like, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:Q5RGU1]
Human Orthologue:
ADCK3
Human Description:
aarF domain containing kinase 3 [Source:HGNC Symbol;Acc:16812]
Mouse Orthologue:
Adck3
Mouse Description:
aarF domain containing kinase 3 Gene [Source:MGI Symbol;Acc:MGI:1914676]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23773 Essential Splice Site Available for shipment Available now
sa29424 Essential Splice Site Mutation detected in F1 DNA During 2018
sa23774 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23773
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004721 Essential Splice Site 91 380 5 11
ENSDART00000020153 Essential Splice Site 330 619 8 14
ENSDART00000135912 Essential Splice Site 313 602 9 15
Genomic Location (Zv9):
Chromosome 20 (position 38525080)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38597492
GRCz11 20 38500371
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAAATGAGCTGCTTGTGAGGGAATGTAAACTCATTTCTGGTTTCCTCA[G/A]TACCCTGGAGTCGCACAGAGCATCAACAGTGATGTCAATAACCTGATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29424
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004721 Essential Splice Site 149 380 6 11
ENSDART00000020153 Essential Splice Site 388 619 9 14
ENSDART00000135912 Essential Splice Site 371 602 10 15
Genomic Location (Zv9):
Chromosome 20 (position 38528330)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38600742
GRCz11 20 38503621
KASP Assay ID:
2261-4743.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGCTGGAGTGCGATTACATAAGAGAAGCCAAGTGTGCTCGCAAATTCAA[G/T]TGAGTGAATACAAACACACAGAGATCTCCTTCTCACTGCTAACCTAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23774
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004721 Essential Splice Site 232 380 8 11
ENSDART00000020153 Essential Splice Site 471 619 11 14
ENSDART00000135912 Essential Splice Site 454 602 12 15
Genomic Location (Zv9):
Chromosome 20 (position 38536665)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38609077
GRCz11 20 38511956
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACGGATCCCAACTGGTCCAATTTCTTTTATGATCCACAAACACATCGG[G/A]TAAGAGAGCGAGAGAGTCTGGATCAGTGTCGGTTTTTTCATAGTATTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link