zgc:110053

Ensembl ID:
ENSDARG00000020122
ZFIN ID:
ZDB-GENE-050522-373
Description:
Poly(U)-specific endoribonuclease-B [Source:UniProtKB/Swiss-Prot;Acc:Q503V9]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43717 Essential Splice Site Mutation detected in F1 DNA During 2018
sa24027 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43717
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014538 Essential Splice Site 200 282 None 7

The following transcripts of ENSDARG00000020122 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 40553044)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 41850663
GRCz11 21 41863873
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAATTTGTTAATTTTTTTATGATCATATTTTCCTTTCATTCTCTCTCCC[A/G]GCCAGACGAGAACAAACACATGCTGGCTCTCCAGTTCAGTTGGAAGAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24027
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014538 Nonsense 202 282 7 7

The following transcripts of ENSDARG00000020122 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 40553036)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 41850655
GRCz11 21 41863865
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAATTTTTTTATGATCATATTTTCCTTTCATTCTCTCTCCCAGCCAGAC[G/T]AGAACAAACACATGCTGGCTCTCCAGTTCAGTTGGAAGAACGGAATTAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link