slc20a1a

Ensembl ID:
ENSDARG00000020114
ZFIN ID:
ZDB-GENE-040426-2217
Description:
Sodium-dependent phosphate transporter 1-A [Source:UniProtKB/Swiss-Prot;Acc:Q6NV12]
Human Orthologue:
SLC20A1
Human Description:
solute carrier family 20 (phosphate transporter), member 1 [Source:HGNC Symbol;Acc:10946]
Mouse Orthologue:
Slc20a1
Mouse Description:
solute carrier family 20, member 1 Gene [Source:MGI Symbol;Acc:MGI:108392]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16896 Nonsense Available for shipment Available now
sa41247 Nonsense Mutation detected in F1 DNA During 2018
sa13777 Nonsense Available for shipment Available now
sa41246 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa16896
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010993 Nonsense 192 652 4 11
ENSDART00000142528   None 179 None 3

The following transcripts of ENSDARG00000020114 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 31916740)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31059466
GRCz11 8 31068698
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCWTCATGTCTGCTRTTCTCTTCTACTTTGTCCGCAAGTTTATCTTGAAC[A/T]AGGTAAAAAAGCAARTCTGAGCTCACTTGTTGCATAATGTACCAATGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41247
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010993 Nonsense 343 652 8 11
ENSDART00000142528   None 179 None 3

The following transcripts of ENSDARG00000020114 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 31911088)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31053814
GRCz11 8 31063046
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAACTGACGGTAAAACATTAAAAAAAAATTTGCTACTTCTTGCAGCTT[T/A]AAACGGCGGTGGCGGTATTGTTATTCCCGACTTGAGCGGAAACCAGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13777
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010993 Nonsense 436 652 8 11
ENSDART00000142528 Nonsense 16 179 1 3

The following transcripts of ENSDARG00000020114 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 31910808)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31053534
GRCz11 8 31062766
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCGSACGGGACTGGATGGAGAAAAGAGGCGCTCGCGGTACGACAGCTA[T/A]AACAGTTACTGTACGGCGGWAGCTGATGGTGAAGCTGCATTGGAGGATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41246
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010993 Nonsense 551 652 9 11
ENSDART00000142528 Nonsense 131 179 2 3

The following transcripts of ENSDARG00000020114 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 31907840)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31050566
GRCz11 8 31059798
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGCTTCTCTTATACGGTGGAGTGGGCATCTGTACAGGACTCTGGATTT[G/A]GGGTCGCAGGGTTATTCAAACCATGGGCAAAGACCTGACACCCATCACCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link