si:dkey-261e22.1

Ensembl ID:
ENSDARG00000020086
ZFIN ID:
ZDB-GENE-041210-122
Description:
Novel protein similar to vertebrate protein kinase family [Source:UniProtKB/TrEMBL;Acc:Q5RH93]
Human Orthologue:
NUAK1
Human Description:
NUAK family, SNF1-like kinase, 1 [Source:HGNC Symbol;Acc:14311]
Mouse Orthologue:
Nuak1
Mouse Description:
NUAK family, SNF1-like kinase, 1 Gene [Source:MGI Symbol;Acc:MGI:1925226]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7550 Missense Mutation detected in F1 DNA During 2018
sa13290 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7550
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007103 Missense 102 617 2 7
ENSDART00000134483 Missense 63 578 2 7
Genomic Location (Zv9):
Chromosome 4 (position 13431160)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14367013
GRCz11 4 14365768
KASP Assay ID:
554-4342.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAAGGAGAAGATAAAAGATGAACAAGACATGGTGCACATCCGCAGAGAA[A/T]TCGAGATCATGTCTTCGCTCCGCCATCCACACATCATCTCTATATATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13290
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007103 Nonsense 103 617 2 7
ENSDART00000134483 Nonsense 64 578 2 7
Genomic Location (Zv9):
Chromosome 4 (position 13431163)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14367016
GRCz11 4 14365771
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGAAGATAAAAGATGAACAAGACATGGTGCACATCCGCAGAGAAWTC[G/T]AGATCATRTCTTCGCTCCGCCATCCACACATCATCTCTATATATGAAGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link