ek1

Ensembl ID:
ENSDARG00000020080
ZFIN ID:
ZDB-GENE-990415-58
Description:
Ephrin type-A receptor 3 [Source:UniProtKB/Swiss-Prot;Acc:O13146]
Human Orthologue:
EPHA4
Human Description:
EPH receptor A4 [Source:HGNC Symbol;Acc:3388]
Mouse Orthologue:
Epha4
Mouse Description:
Eph receptor A4 Gene [Source:MGI Symbol;Acc:MGI:98277]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44161 Nonsense Mutation detected in F1 DNA During 2018
sa39457 Nonsense Mutation detected in F1 DNA During 2018
sa24519 Nonsense Available for shipment Available now
sa37911 Nonsense Available for shipment Available now
sa8415 Nonsense Mutation detected in F1 DNA During 2018
sa8869 Nonsense Mutation detected in F1 DNA During 2018
sa37912 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44161
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105774 Nonsense 47 981 2 17

The following transcripts of ENSDARG00000020080 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 28441404)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 27491991
GRCz11 24 27571150
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCTGCTTGACTCCATGTCCGCCCCAGGTGATCTGGGTTGGGAAGCGTA[T/A]CCATCAGAGGGGGTGAGTATCAGTGAAAGTCCTCTTAACACAACCGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39457
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105774 Nonsense 81 981 3 17

The following transcripts of ENSDARG00000020080 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 28442780)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 27493367
GRCz11 24 27572526
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGGACTTACCAGGTATGCAACGTAATGGAAGCCAATCAGAACAACTG[G/A]TTGCGTACTGGACTGATTCAACGAGAAGGTGCTCAGCGCGTCTATGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24519
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105774 Nonsense 157 981 3 17

The following transcripts of ENSDARG00000020080 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 28443006)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 27493593
GRCz11 24 27572752
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAACCAGTACATCAAGATCGACACTATAGCAGCTGACGAGAGCTTCACA[C/T]AGACAGACGTTGGGGATCGTGTGATGAAGTTAAACACAGAAGTACGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37911
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105774 Nonsense 315 981 4 17

The following transcripts of ENSDARG00000020080 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 28477577)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 27528164
GRCz11 24 27607323
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCTCACCAGGACAAGGCCTCTGAGTGTGTATGTGAACGAGGTTTCTAT[C/T]GAGCAGAATCAGACCCTCGCTCTATGGCCTGCACAAGTAAGCTGATACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8415
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105774 Nonsense 689 981 11 17
ENSDART00000105774 Nonsense 689 981 11 17

The following transcripts of ENSDARG00000020080 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 28547973)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 27598560
GRCz11 24 27677719
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGAGYGAGGCCAGCATTATGGGCCAGYTYGACCACCCTAACATCATT[C/T]GACTGGAAGGAGTTGTCACCAGATGTAAGCGTTTATATCCCAKTCACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8869
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105774 Nonsense 689 981 11 17
ENSDART00000105774 Nonsense 689 981 11 17

The following transcripts of ENSDARG00000020080 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 28547973)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 27598560
GRCz11 24 27677719
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGAGYGAGGCCAGCATTATGGGCCAGYTYGACCACCCTAACATCATT[C/T]GACTGGAAGGAGTTGTCACCAGATGTAAGCGTTTATATCCCAKTCACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37912
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105774 Nonsense 815 981 14 17

The following transcripts of ENSDARG00000020080 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 28573405)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 27623992
GRCz11 24 27703151
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGCCATCACCTACAGGAAGTTTACCTCAGCCAGTGATGTATGGAGTTA[C/A]GGCATTGTCATGTGGGAGGTGATATCCTATGGGGAGCGACCGTACTGGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Brain imaging: Whole genome association study of brain-wide imaging phenotypes for identifying quantitative trait loci in MCI and AD: A study of the ADNI cohort. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link