wu:fi25h02

Ensembl ID:
ENSDARG00000020076
ZFIN ID:
ZDB-GENE-030131-5928
Description:
Wu:fi25h02 protein [Source:UniProtKB/TrEMBL;Acc:Q504G9]
Human Orthologue:
BRDT
Human Description:
bromodomain, testis-specific [Source:HGNC Symbol;Acc:1105]
Mouse Orthologue:
Brdt
Mouse Description:
bromodomain, testis-specific Gene [Source:MGI Symbol;Acc:MGI:1891374]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20686 Nonsense Available for shipment Available now
sa33848 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa20686
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040706   None 600 None 11
ENSDART00000130916 Nonsense 593 913 11 20
Genomic Location (Zv9):
Chromosome 6 (position 20594514)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 24282408
GRCz11 6 24382217
KASP Assay ID:
2259-7433.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCTAAAATCAAGGAAAAGGATAAAGACCTACAACACGCAACTGGAGAA[C/T]AAAACTCTCATAAAAAGACCAAAAGTAAGTATATACAGTTACATATATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33848
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040706   None 600 None 11
ENSDART00000130916 Nonsense 876 913 19 20
Genomic Location (Zv9):
Chromosome 6 (position 20582386)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 24270280
GRCz11 6 24370089
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAAGCCCCTGAGCCCAGTTCTGTTCTGCAGAACTCTGTTGACCGAGAA[C/T]GAGAGATGGCACGCAAGAGAGAACAAGAGCGCCGCAGGAGAGAGGCTGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link