zgc:163107

Ensembl ID:
ENSDARG00000020041
ZFIN ID:
ZDB-GENE-070521-7
Description:
UPF0505 protein C16orf62 homolog [Source:UniProtKB/Swiss-Prot;Acc:A4VCH4]
Human Orthologue:
C16orf62
Human Description:
chromosome 16 open reading frame 62 [Source:HGNC Symbol;Acc:24641]
Mouse Orthologue:
9030624J02Rik
Mouse Description:
RIKEN cDNA 9030624J02 gene Gene [Source:MGI Symbol;Acc:MGI:1918767]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41974 Splice Site, Nonsense Mutation detected in F1 DNA During 2018
sa41975 Essential Splice Site Mutation detected in F1 DNA During 2018
sa8607 Nonsense Mutation detected in F1 DNA During 2018
sa35224 Essential Splice Site Mutation detected in F1 DNA During 2018
sa13664 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa41974
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052537 Splice Site, Nonsense 6 963 2 30
Genomic Location (Zv9):
Chromosome 12 (position 12274434)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 11130087
GRCz11 12 11168390
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAAAATGTTAAAATGTCAGCTTTTATGTAAATGTGTGTGTTCTGCACAG[G/A]CACTCCAGGAGCCGTAAATATGACAGTGAGTGGCAGGCGAGTCGTTTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41975
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052537 Essential Splice Site 424 963 14 30
Genomic Location (Zv9):
Chromosome 12 (position 12285126)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 11140779
GRCz11 12 11179082
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTTCTGCTAACTGAGATGATGGACAGATGCAAGAAGTTAGGCAACAAG[T/A]AAGATCTCACCACTGAGGCACTTTTCAATGGAAAATTTTGCATTGTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8607
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052537 Nonsense 481 963 16 30
Genomic Location (Zv9):
Chromosome 12 (position 12286156)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 11141809
GRCz11 12 11180112
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTGCATCTCTGGGCCGCAGTCTGTCCTGTGCKGACCCTCCAGAGAGC[G/T]AGAGACTCTCCATACTCAATGAAGCCTGGAAGGTCATCACTAAAGTTCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35224
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052537 Essential Splice Site 546 963 19 30
Genomic Location (Zv9):
Chromosome 12 (position 12290193)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 11145846
GRCz11 12 11184149
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACATTGATGTTGTCAGAGCACTTCATTGCTCTTCTTTTGTTTCTTTCC[A/T]GTTGCAGTCAGTGATTAAGAAGATCCTCACCTACTTCCATGATTTCTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13664
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052537 Essential Splice Site 740 963 25 30
Genomic Location (Zv9):
Chromosome 12 (position 12296375)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 11152028
GRCz11 12 11190331
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATCTGCTGTCTGGACAARTAGCGCTGGCCAACCAGTGTCTGTCCCAGG[G/A]TAAGTGGGTGCTGGAGATTTTGCTTTTCAAAGATATTTTTSCWGACYAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link