si:dkey-225d17.3

Ensembl ID:
ENSDARG00000020028
ZFIN ID:
ZDB-GENE-081105-17
Description:
Novel protein similar to vertebrate carbamoyl-phosphate synthetase 1, mitochondrial (CPS1) [Source:U
Human Orthologue:
CPS1
Human Description:
carbamoyl-phosphate synthase 1, mitochondrial [Source:HGNC Symbol;Acc:2323]
Mouse Orthologue:
Cps1
Mouse Description:
carbamoyl-phosphate synthetase 1 Gene [Source:MGI Symbol;Acc:MGI:891996]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41493 Essential Splice Site Mutation detected in F1 DNA During 2018
sa7635 Missense Mutation detected in F1 DNA During 2018
sa44709 Nonsense Mutation detected in F1 DNA During 2018
sa34714 Essential Splice Site Mutation detected in F1 DNA During 2018
sa18960 Nonsense Mutation detected in F1 DNA During 2018
sa10807 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41493
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004742 Essential Splice Site 68 1482 2 38
Genomic Location (Zv9):
Chromosome 9 (position 40082114)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 39220010
GRCz11 9 39029805
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGATCAGTCTGCAGCTGGAGAGCTGGTCTTCAACACAGGACTAGTTGG[G/A]TGAGAAGGCATCCTCTGAATATGGTCATGCATAAATATATTGTTTTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7635
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004742 Missense 138 1482 4 38
Genomic Location (Zv9):
Chromosome 9 (position 40083768)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 39221664
GRCz11 9 39031459
KASP Assay ID:
554-4361.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTCAGGATTATAGTGCTGAGTACAGCCACTGGAACTCTGTGAAATCCT[T/C]AGCACAGTGGCTTCAAGAGGAGAAGGTGTGTTTATCTTAATAAATGTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44709
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004742 Nonsense 959 1482 24 38
Genomic Location (Zv9):
Chromosome 9 (position 40116404)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 39254300
GRCz11 9 39064095
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGTAATTATCCAATTTTTCTTTTTGTCCTTGTCGACAGGAGCATGATT[T/A]GGATTTTAAGGACCATGGCACCATGGTTGTTGGTTGCGGTCCATATCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34714
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004742 Essential Splice Site 1150 1482 28 38
Genomic Location (Zv9):
Chromosome 9 (position 40150386)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 39288282
GRCz11 9 39098077
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAGGATGAGATGAAACGTTTCCTGGAGGAAGCCACACAGGTTTCACAG[G/A]TGAGCTCTGAAGATTTAGCCATTTGGACCTTTGCCACAAAAAAAAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18960
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004742 Nonsense 1161 1482 29 38
ENSDART00000004742 Nonsense 1161 1482 29 38
Genomic Location (Zv9):
Chromosome 9 (position 40152210)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 39290106
GRCz11 9 39099901
KASP Assay ID:
2260-2234.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCATTTTCTCTAAAACAGGATCATCCTGTGGTCATCACCAAATTCATC[C/T]GAGGTGCCAGAGAGGTGGAGGTTGATGCGGTGGCCAGGATGGGCAAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10807
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004742 Nonsense 1161 1482 29 38
ENSDART00000004742 Nonsense 1161 1482 29 38
Genomic Location (Zv9):
Chromosome 9 (position 40152210)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 39290106
GRCz11 9 39099901
KASP Assay ID:
2260-2234.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCATTTTCTCTAAAACAGGATCATCCWGTGGTCATCACCAAATTCATC[C/T]GAGGTGCCAGAGAGGTGGAGGTTGATGCGGTGGCCAGGATGGGCAAGGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Chronic kidney disease: New loci associated with kidney function and chronic kidney disease. (View Study)
  • Fibrinogen: Novel loci, including those related to Crohn disease, psoriasis, and inflammation, identified in a genome-wide association study of fibrinogen in 17 686 women: the Women's Genome Health Study. (View Study)
  • Homocysteine levels: Genome-wide association study of homocysteine levels in Filipinos provides evidence for CPS1 in women and a stronger MTHFR effect in young adults. (View Study)
  • Metabolic traits: Human metabolic individuality in biomedical and pharmaceutical research. (View Study)
  • Metabolite levels: Genetic variants associated with glycine metabolism and their role in insulin sensitivity and type 2 diabetes. (View Study)
  • Non-small cell lung cancer: Prognostic implications of genetic variants in advanced non-small cell lung cancer: a genome-wide association study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link