
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
bmp2k
- Ensembl ID:
- ENSDARG00000020009
- ZFIN ID:
- ZDB-GENE-041212-72
- Description:
- BMP-2-inducible protein kinase isoform 2 [Source:RefSeq peptide;Acc:NP_001008644]
- Human Orthologues:
- BMP2K, BMP2KL
- Human Descriptions:
- BMP2 inducible kinase [Source:HGNC Symbol;Acc:18041]
- BMP2 inducible kinase-like [Source:HGNC Symbol;Acc:17080]
- Mouse Orthologue:
- Bmp2k
- Mouse Description:
- BMP2 inducible kinase Gene [Source:MGI Symbol;Acc:MGI:2155456]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa6995 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa40519 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa12724 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa6995
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006079 | Nonsense | 48 | 645 | 1 | 15 |
- Genomic Location (Zv9):
- Chromosome 5 (position 40700366)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 38499756 GRCz11 5 39099909 - KASP Assay ID:
- 554-5144.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGGTGTTTGCTGTCGGTCGATACCAAGTGACTGTGGAGGAGCTTATCGCT[G/T]AAGGTAAATGCATGCACTGGATTTAGGCCAAAGAAAAGATYATGGTCAGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40519
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006079 | Nonsense | 574 | 645 | 14 | 15 |
- Genomic Location (Zv9):
- Chromosome 5 (position 40743055)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 38542445 GRCz11 5 39142598 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGATGTCATGAGCCCCCCTCCACAGACCGTCAGCAACCCTCCTGATATGT[C/A]AAGCTGGAACCCCTTTGGAGAAGATAATTTCTCTAAACTCACCGAAGAGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12724
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006079 | Essential Splice Site | 603 | 645 | 14 | 15 |
- Genomic Location (Zv9):
- Chromosome 5 (position 40743143)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 38542533 GRCz11 5 39142686 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTCACCGAAGAGGAGCTTCTCRATCGAGAATTCGACCTTCTWAGAGCAAG[C/T]AAGTGTCTCTGTTTATTTCTGCACAACCTGACCANNCTCTCTCTCTCCTCTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: