smarcd3b

Ensembl ID:
ENSDARG00000019969
ZFIN ID:
ZDB-GENE-080509-2
Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3b
Human Orthologue:
SMARCD3
Human Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 [S
Mouse Orthologue:
Smarcd3
Mouse Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 Ge

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12626 Essential Splice Site Available for shipment Available now
sa12191 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12626
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006724 Essential Splice Site 90 476 2 13
Genomic Location (Zv9):
Chromosome 7 (position 44187812)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41178112
GRCz11 7 41458185
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCACAGCAGCAGATCCAGCAGCAGGCCGTACAGAACCGAAACAGAAAG[T/A]GAGTATAATACGACATGCTCAAGAAGATCCTATAAAGATACAGTAAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12191
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006724 Nonsense 310 476 9 13
Genomic Location (Zv9):
Chromosome 7 (position 44174953)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41165253
GRCz11 7 41445326
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAWTGAARARCTGTNNTTTTGCCTTCATCTCCTCTCATAGATCTTTGACTG[T/A]CCACGTCTGAARTTCTCTGAAATTCCCCAGCGCCTCACCAACCTTTTACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • IgG glycosylation: Loci associated with N-glycosylation of human immunoglobulin G show pleiotropy with autoimmune diseases and haematological cancers. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link