ZNF513

Ensembl ID:
ENSDARG00000019961
Description:
zinc finger protein 513 [Source:HGNC Symbol;Acc:26498]
Human Orthologue:
ZNF513
Human Description:
zinc finger protein 513 [Source:HGNC Symbol;Acc:26498]
Mouse Orthologue:
Zfp513
Mouse Description:
zinc finger protein 513 Gene [Source:MGI Symbol;Acc:MGI:2141255]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43410 Nonsense Mutation detected in F1 DNA During 2018
sa45692 Essential Splice Site Mutation detected in F1 DNA During 2018
sa15908 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43410
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023646 Nonsense 6 495 1 6
Genomic Location (Zv9):
Chromosome 20 (position 19496629)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 19524886
GRCz11 20 19424469
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGGAGGTTGCACATATAAAAGGCTGTCTGGAAGATGCCAAGAAGAAAA[C/T]AGCAGAATCCACAACCTGTCAAATGTAAGCTGCTTTTTGAGTAATACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45692
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023646 Essential Splice Site 68 495 3 6
Genomic Location (Zv9):
Chromosome 20 (position 19500792)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 19529049
GRCz11 20 19428632
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAATGACCAAAAGATCATAGGCCTTGAAAAGTTCTCAGGTGAGATATG[C/A]AAGTTTACAATCTAAGCTTGTTATTGAAATGTTCCTGTCATCAATTACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15908
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023646 Nonsense 121 495 5 6
Genomic Location (Zv9):
Chromosome 20 (position 19502271)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 19530528
GRCz11 20 19430111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAATGTGGAAGGCRTTGTGGACAGGAAGCTYTGCTCGGGCTTAGGCTTA[C/T]AAGCAGAGTCTAGAGGGGGAGGGAATGAGGGGACTGGTGAGGACGGTTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link