zgc:85963

Ensembl ID:
ENSDARG00000019917
ZFIN ID:
ZDB-GENE-040516-6
Description:
hypothetical protein LOC407981 [Source:RefSeq peptide;Acc:NP_999977]
Human Orthologue:
EPB41L3
Human Description:
erythrocyte membrane protein band 4.1-like 3 [Source:HGNC Symbol;Acc:3380]
Mouse Orthologue:
Epb4.1l3
Mouse Description:
erythrocyte protein band 4.1-like 3 Gene [Source:MGI Symbol;Acc:MGI:103008]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39960 Nonsense Mutation detected in F1 DNA During 2018
sa7313 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39960
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004431 Nonsense 118 838 4 29
Genomic Location (Zv9):
Chromosome 2 (position 59027563)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 58085195
GRCz11 2 58571168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTAATCTGCAATTGCCTCTCTGGATATACCACTAACTGTACTTAAAAA[A/T]AAATAAATAAATAAAAATTACTAATGTTTTGCTTCTTACACTTTACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7313
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004431 Essential Splice Site 742 838 26 29
Genomic Location (Zv9):
Chromosome 2 (position 58975100)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 58032732
GRCz11 2 58518705
KASP Assay ID:
554-4948.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGATTCTGCAGTGATGTGAAGTGTGCTGTGTTTGCCCCAGAGTTCAGAG[G/A]TAAAGACTCCCTCTGCTGGTGAAAAACTAAAGYACATGAAGGCTCTCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link