zgc:136875

Ensembl ID:
ENSDARG00000019897
ZFIN ID:
ZDB-GENE-060421-5102
Description:
glycerol-3-phosphate acyltransferase 4 [Source:RefSeq peptide;Acc:NP_001035339]
Human Orthologue:
AGPAT6
Human Description:
1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta) [Source
Mouse Orthologue:
Agpat6
Mouse Description:
1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta) Gene [S

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15005 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15005
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009838 Essential Splice Site 317 451 9 13

The following transcripts of ENSDARG00000019897 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 42735206)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 41448760
GRCz11 10 41370640
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACCATGTTGCTGACGAAAGCAAACTSCCTATCCTCATATTTCCAGAAG[G/A]TGAGTGTTAGAAGTGTTTCTGTTATCATTTCATTAACTATTCANNNNAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link