zgc:110077

Ensembl ID:
ENSDARG00000019797
ZFIN ID:
ZDB-GENE-030131-8204
Description:
glutamine-rich protein 1 [Source:RefSeq peptide;Acc:NP_001020633]
Human Orthologue:
QRICH1
Human Description:
glutamine-rich 1 [Source:HGNC Symbol;Acc:24713]
Mouse Orthologue:
Qrich1
Mouse Description:
glutamine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1916482]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35055 Essential Splice Site Mutation detected in F1 DNA During 2018
sa15035 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35055
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040171 Essential Splice Site 574 717 10 12
Genomic Location (Zv9):
Chromosome 11 (position 18501677)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 17867513
GRCz11 11 18002148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACACACACACACACACACACACTGGAGTTCAAATGTCATCTTTTCACA[G/A]GTACTTTCACTTGACCACAGTGGAGCAGCATATGAAAGTGGCCTTCTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15035
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040171 Essential Splice Site 624 717 10 12
Genomic Location (Zv9):
Chromosome 11 (position 18501524)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 17867360
GRCz11 11 18001995
GRCz11 11 18089771
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCATCCGCWACCTGAAAGGAGTTGGACCACACCAWGTCGGACAGAAAG[G/A]TTAGGATTTGGGYTAAAATGGCCAGATGTTGTCATGTTACAMAGAAAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link