zhx3

Ensembl ID:
ENSDARG00000019774
ZFIN ID:
ZDB-GENE-031107-1
Description:
zinc fingers and homeoboxes 3 [Source:RefSeq peptide;Acc:NP_942108]
Human Orthologue:
ZHX3
Human Description:
zinc fingers and homeoboxes 3 [Source:HGNC Symbol;Acc:15935]
Mouse Orthologue:
Zhx3
Mouse Description:
zinc fingers and homeoboxes 3 Gene [Source:MGI Symbol;Acc:MGI:2444772]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24246 Nonsense Available for shipment Available now
sa39392 Nonsense Mutation detected in F1 DNA During 2018
sa43907 Nonsense Mutation detected in F1 DNA During 2018
sa8691 Nonsense Mutation detected in F1 DNA During 2018
sa43906 Nonsense Mutation detected in F1 DNA During 2018
sa31080 Nonsense Mutation detected in F1 DNA During 2018
sa24245 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24246
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022413 Nonsense 68 1083 1 1
ENSDART00000121899 Nonsense 68 1075 1 2
Genomic Location (Zv9):
Chromosome 23 (position 2890035)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2936292
GRCz11 23 2879988
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGACAAGTCCTCTGGGCAAGAAGATATCCTTAAAGATGCTGGATTTTA[C/A]ACTTGTAGACCATGTAACTTTGAGACCCAGGATCTTAATCTTTTCCTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39392
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022413 Nonsense 350 1083 1 1
ENSDART00000121899 Nonsense 350 1075 1 2
Genomic Location (Zv9):
Chromosome 23 (position 2889189)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2935446
GRCz11 23 2879142
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATCAAGATCTGGTTCACAGCACAAAGGCTGAAACAAGGAATCAGCTG[G/A]TCTCCAGAGGAAATAGAAGAGGCCCGAAGAAAAATGTTCAACACAATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43907
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022413 Nonsense 726 1083 1 1
ENSDART00000121899 Nonsense 726 1075 1 2
Genomic Location (Zv9):
Chromosome 23 (position 2888063)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2934320
GRCz11 23 2878016
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGTCCCACACAGACATCATCACCGCCAACTCCAACACGTCGTCCTCCA[C/T]GACCCCCTTCACCAGATTTTACGGCTATACGCTACAAAGAGCGAGAGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8691
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022413 Nonsense 737 1083 1 1
ENSDART00000121899 Nonsense 737 1075 1 2
Genomic Location (Zv9):
Chromosome 23 (position 2888028)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2934285
GRCz11 23 2877981
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACGWCGTCCTCCMCGACCCCCTTCWCCRGATTTTACGGCTATACGCTA[C/A]AAAGAGCGAGAGCCTCACCAGGTTCGAGCTTTMGAGGCAAGCTTTACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43906
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022413 Nonsense 746 1083 1 1
ENSDART00000121899 Nonsense 746 1075 1 2
ENSDART00000022413 Nonsense 746 1083 1 1
ENSDART00000121899 Nonsense 746 1075 1 2
Genomic Location (Zv9):
Chromosome 23 (position 2888003)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2934260
GRCz11 23 2877956
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCAGATTTTACGGCTATACGCTACAAAGAGCGAGAGCCTCACCAGGTT[C/T]GAGCTTTAGAGGCAAGCTTTACACAAGAGCCAGATCCAACTAGTGAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31080
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022413 Nonsense 746 1083 1 1
ENSDART00000121899 Nonsense 746 1075 1 2
ENSDART00000022413 Nonsense 746 1083 1 1
ENSDART00000121899 Nonsense 746 1075 1 2
Genomic Location (Zv9):
Chromosome 23 (position 2888003)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2934260
GRCz11 23 2877956
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCAGATTTTACGGCTATACGCTACAAAGAGCGAGAGCCTCACCAGGTT[C/T]GAGCTTTAGAGGCAAGCTTTACACAAGAGCCAGATCCAACTAGTGAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24245
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022413 Nonsense 791 1083 1 1
ENSDART00000121899 Nonsense 791 1075 1 2
Genomic Location (Zv9):
Chromosome 23 (position 2887868)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2934125
GRCz11 23 2877821
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGTGAGATCCATGGTTGGTTTGCTGAGCGGCGAAGGAGGGTAGCAGCA[G/T]AGAAGAAGAAAGAGGAAGCTGAGAAGGCGGAAAGAGAAGATGATGATTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link