si:dkey-45h18.1

Ensembl ID:
ENSDARG00000019753
ZFIN ID:
ZDB-GENE-100921-56
Human Orthologue:
KCNN3
Human Description:
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3 [Source:HG
Mouse Orthologue:
Kcnn3
Mouse Description:
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3 Gene [Sour

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42716 Nonsense Mutation detected in F1 DNA During 2018
sa39099 Essential Splice Site Mutation detected in F1 DNA During 2018
sa36115 Nonsense Mutation detected in F1 DNA During 2018
sa22833 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42716
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103211 Nonsense 208 771 1 9
ENSDART00000131627 Nonsense 208 771 2 10
Genomic Location (Zv9):
Chromosome 16 (position 25839955)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 23685630
GRCz11 16 23600662
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACCAAAGAGGGTGGTGCGAGCACAAGCCAGGTGACCGCGGCCTCCTCT[C/T]AGCACAGCCAGCCCCAACCCCAGAACCCCCCAGAGATCGTTATCTCCTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39099
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103211 Essential Splice Site 510 771 4 9
ENSDART00000131627 Essential Splice Site 510 771 5 10
Genomic Location (Zv9):
Chromosome 16 (position 25916406)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 23762081
GRCz11 16 23677113
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATCTCCCTGTGGATCATCGCTGCCTGGACCGTACGAGTGTGTGAGAGG[T/G]AAGAAAGAGAAAACGAATGAACAAATGAATCATTGTGTTTGGAGCTGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36115
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103211 Nonsense 626 771 7 9
ENSDART00000131627 Nonsense 626 771 8 10
Genomic Location (Zv9):
Chromosome 16 (position 25946325)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 23792000
GRCz11 16 23707032
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTACAAGCACACCAAGCTGATGAAGAAAATCGACCACTCCCGTGTGCGC[A/T]AACATCAGAGGAAGTTCCTTCAAGCCATTCACCAGTGAGAGAAACAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22833
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103211 Nonsense 655 771 8 9
ENSDART00000131627 Nonsense 655 771 9 10
Genomic Location (Zv9):
Chromosome 16 (position 25949259)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 23794934
GRCz11 16 23709966
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGAAGCGTAAAAATGGAGCAGAGAAAACTCAGTGATCAAGCCAATACAT[T/A]GGTGGACTTATCAAAGGTAAGACTATTGTACATGTACACAAATCACAGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link