zgc:73336

Ensembl ID:
ENSDARG00000019752
ZFIN ID:
ZDB-GENE-040426-1765
Description:
hypothetical protein LOC393767 [Source:RefSeq peptide;Acc:NP_957088]
Human Orthologue:
ROM1
Human Description:
retinal outer segment membrane protein 1 [Source:HGNC Symbol;Acc:10254]
Mouse Orthologue:
Rom1
Mouse Description:
rod outer segment membrane protein 1 Gene [Source:MGI Symbol;Acc:MGI:97998]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16839 Nonsense Available for shipment Available now
sa33767 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa16839
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011295 Nonsense 176 346 2 4
Genomic Location (Zv9):
Chromosome 5 (position 70133598)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66459756
GRCz11 5 67138125
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGATGGAGTTCCACTGCTGCGGAAACACAGACTACAGGGATTGGTTC[G/T]AGGTGCAGTGSATCAGCAACCGCTACCTGGATTTCAGCTCTAAGGAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33767
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011295 Essential Splice Site 194 346 2 4
Genomic Location (Zv9):
Chromosome 5 (position 70133541)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66459699
GRCz11 5 67138068
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGATCAGCAACCGCTACCTGGATTTCAGCTCTAAGGAAGTTAAGGAG[T/C]GAGTAAAACAGAATTTTAGTCAAAGAAATAGCTCATCCTAAAAATAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link