zgc:101748

Ensembl ID:
ENSDARG00000019707
ZFIN ID:
ZDB-GENE-040912-53
Description:
hypothetical protein LOC447888 [Source:RefSeq peptide;Acc:NP_001004627]
Human Orthologue:
C9orf114
Human Description:
chromosome 9 open reading frame 114 [Source:HGNC Symbol;Acc:26933]
Mouse Orthologue:
D2Wsu81e
Mouse Description:
DNA segment, Chr 2, Wayne State University 81, expressed Gene [Source:MGI Symbol;Acc:MGI:106544]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32325 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32325
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099535   None 381 None 12
ENSDART00000144515   None 241 None 9
ENSDART00000146754 Essential Splice Site None 278 1 10

The following transcripts of ENSDARG00000019707 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 4047574)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3644830
GRCz11 21 3796251
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTAAACACACACGCAGCCACATGTCAGGCAAACTCGCTCTAAACAAAG[G/A]TTTTTACACGACATTGACGGTCATTTTCTACTTACCATGATGAAGTCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link