zar1

Ensembl ID:
ENSDARG00000019706
ZFIN ID:
ZDB-GENE-030818-1
Description:
Zygote arrest protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q7T3T8]
Human Orthologue:
ZAR1
Human Description:
zygote arrest 1 [Source:HGNC Symbol;Acc:20436]
Mouse Orthologue:
Zar1
Mouse Description:
zygote arrest 1 Gene [Source:MGI Symbol;Acc:MGI:2180337]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23691 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23691
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004625 Nonsense 257 329 2 4

The following transcripts of ENSDARG00000019706 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 23412943)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 23526330
GRCz11 20 23425430
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAACCTACGGTGGGAAAGTGCTTATGTGTGGTGTGTCCAAGGAACAAAC[A/T]AGGTAATATTTTGTACACGCACAAACAAAATCTTAATTCCGTAAAACTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link