Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000019669
- Ensembl ID:
- ENSDARG00000019669
- Human Orthologue:
- CASKIN1
- Human Description:
- CASK interacting protein 1 [Source:HGNC Symbol;Acc:20879]
- Mouse Orthologue:
- Caskin1
- Mouse Description:
- CASK interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:2442952]
Alleles
There are 3 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa24770 | Nonsense | Available for shipment | Available now |
| sa30407 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa24771 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa24770
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000048631 | Nonsense | 290 | 618 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome Zv9_NA885 (position 11672)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 KN150709.1 11672 GRCz11 KN150709.1 11672 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGCCAATGTGGCTTCTTACGCCACACTCACTCGCAAACCCGGCCGCAGT[C/T]AACCATCTTTCGCCTCCAGTGATCGCCATGTAGGCCGCAGTCATTCCTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa30407
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000048631 | Nonsense | 341 | 618 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome Zv9_NA885 (position 11825)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 KN150709.1 11825 GRCz11 KN150709.1 11825 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTCTGCCCAAAGTGGAGTAACTTCATGTGGGGTTGAAACAGAGAGTGCT[G/T]GAAGTGTCCGAAGCATTGCAGCTCGACTAGAGAGCAGTACAGGAAGCCCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24771
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000048631 | Nonsense | 391 | 618 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome Zv9_NA885 (position 11977)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 KN150709.1 11977 GRCz11 KN150709.1 11977 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCAAAAAATACAGAGAACCGTAGGAGGACCACTAGCGACTGCTCCACATA[T/A]GAAACGAAGCATGCAGATCAAAACGTTAGTCCTTTGAGGCACCAACAAGT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
