zgc:73136

Ensembl ID:
ENSDARG00000019636
ZFIN ID:
ZDB-GENE-030131-6922
Description:
Protein YIF1A [Source:UniProtKB/Swiss-Prot;Acc:Q6PC24]
Human Orthologue:
YIF1A
Human Description:
Yip1 interacting factor homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:16688]
Mouse Orthologue:
Yif1a
Mouse Description:
Yip1 interacting factor homolog A (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1915340]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39006 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39006
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009385 Nonsense 117 307 4 9
ENSDART00000137782 Nonsense 117 307 3 8
Genomic Location (Zv9):
Chromosome 14 (position 31624535)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 30414592
GRCz11 14 30754906
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGAAGTATTTCTTCGCAGTCGATACCAAATATGTTATGAAGAAACTGT[T/A]GCTTCTCATGTTCCCATACACACATCAGGTAAAATGTTAATTCCTAAATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link