uso1

Ensembl ID:
ENSDARG00000019581
ZFIN ID:
ZDB-GENE-040426-688
Description:
general vesicular transport factor p115 [Source:RefSeq peptide;Acc:NP_956449]
Human Orthologue:
USO1
Human Description:
USO1 vesicle docking protein homolog (yeast) [Source:HGNC Symbol;Acc:30904]
Mouse Orthologue:
Uso1
Mouse Description:
USO1 homolog, vesicle docking protein (yeast) Gene [Source:MGI Symbol;Acc:MGI:1929095]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1282 Essential Splice Site F2 line generated During 2018

Mutation Details

Allele Name:
sa1282
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011809 Essential Splice Site 52 956 3 26
ENSDART00000112329 Essential Splice Site 52 956 3 26
ENSDART00000137492   None 414 None 9
ENSDART00000140976 Essential Splice Site 52 219 3 8

The following transcripts of ENSDARG00000019581 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 25356179)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25779877
GRCz11 1 26473591
KASP Assay ID:
554-1197.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGCAATAGTTGTTTGTGGAACATGTAAAATAATTTTTTTTTTTATTTC[A/T]GAAATATCGTCTGGAGGTTGGGACAATGTCAATGGACCATTTGGTTCGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link