sp7

Ensembl ID:
ENSDARG00000019516
ZFIN ID:
ZDB-GENE-040629-2
Description:
transcription factor Sp7 [Source:RefSeq peptide;Acc:NP_998028]
Human Orthologue:
SP7
Human Description:
Sp7 transcription factor [Source:HGNC Symbol;Acc:17321]
Mouse Orthologue:
Sp7
Mouse Description:
Sp7 transcription factor 7 Gene [Source:MGI Symbol;Acc:MGI:2153568]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40813 Nonsense Mutation detected in F1 DNA During 2018
sa11475 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40813
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128793 Nonsense 281 440 3 3
Genomic Location (Zv9):
Chromosome 6 (position 58572278)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 58675406
GRCz11 6 58669637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATTGAGTCATTATCTCTCTGCAGGTCTTCTTGCGATTGCCCGAATTG[T/A]CAGGAGCTGGAAAGGCTCGGAGCGTCAGCAGCATCGCTGCGGAAGAAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11475
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128793 Nonsense 293 440 3 3
Genomic Location (Zv9):
Chromosome 6 (position 58572313)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 58675441
GRCz11 6 58669672
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGATTGCCCGAATTGTCAGGAGCTGGAAAGGCTCGGAGCGTCAGCAGCAT[C/A]GCTGCGGAAGAAACCTGTCCACAGCKGCCACATCCCCGGCTGCGGGAAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link