zdhhc7

Ensembl ID:
ENSDARG00000019484
ZFIN ID:
ZDB-GENE-040718-346
Description:
palmitoyltransferase ZDHHC7 [Source:RefSeq peptide;Acc:NP_001002602]
Human Orthologue:
ZDHHC7
Human Description:
zinc finger, DHHC-type containing 7 [Source:HGNC Symbol;Acc:18459]
Mouse Orthologue:
Zdhhc7
Mouse Description:
zinc finger, DHHC domain containing 7 Gene [Source:MGI Symbol;Acc:MGI:2142662]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1787 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1787
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020233 Essential Splice Site 138 299 4 8
Genomic Location (Zv9):
Chromosome 18 (position 4458114)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 5207785
GRCz11 18 5822538
KASP Assay ID:
554-1780.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGTCCCAAGTGCTGCAGCATTAAACCAGAGAGAGCACACCACTGCAGG[T/C]AACACCAATTTTTCACAGGCGCGTGTGTGTGACTGTGTGTTTGATTGTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link