stat5.1

Ensembl ID:
ENSDARG00000019392
ZFIN ID:
ZDB-GENE-030820-2
Description:
signal transducer and activator of transcription 5.1 [Source:RefSeq peptide;Acc:NP_919368]
Human Orthologues:
STAT5A, STAT5B
Human Descriptions:
signal transducer and activator of transcription 5A [Source:HGNC Symbol;Acc:11366]
signal transducer and activator of transcription 5B [Source:HGNC Symbol;Acc:11367]
Mouse Orthologues:
Stat5a, Stat5b
Mouse Descriptions:
signal transducer and activator of transcription 5A Gene [Source:MGI Symbol;Acc:MGI:103036]
signal transducer and activator of transcription 5B Gene [Source:MGI Symbol;Acc:MGI:103035]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33126 Nonsense Mutation detected in F1 DNA During 2018
sa40029 Nonsense Mutation detected in F1 DNA During 2018
sa10709 Nonsense Available for shipment Available now
sa19972 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33126
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024832 Nonsense 200 785 6 19
ENSDART00000132256 Nonsense 200 785 8 21
ENSDART00000139763 Nonsense 200 785 7 20
Genomic Location (Zv9):
Chromosome 3 (position 16921787)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 17128120
GRCz11 3 17277920
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTCAGTTATCGAGTCTGGCGACACTGCCTCCAGCAGACCGACAGCTA[C/T]GAGAGCCTAGCCTGCTCAGCAAGAGAGCCACAGTTGAGGCCTGGCTGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40029
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024832 Nonsense 443 785 11 19
ENSDART00000132256 Nonsense 443 785 13 21
ENSDART00000139763 Nonsense 443 785 12 20
Genomic Location (Zv9):
Chromosome 3 (position 16936819)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 17143152
GRCz11 3 17292952
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGACAGACGGGGGGCAGAATCTGTTACAGAAGAGAAATTCACCATTT[T/A]GTTCGAATCACAGTTCAGCGTTGGTGGAAATGAGCTGGGGTTTCAGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10709
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024832 Nonsense 474 785 12 19
ENSDART00000132256 Nonsense 474 785 14 21
ENSDART00000139763 Nonsense 474 785 13 20
Genomic Location (Zv9):
Chromosome 3 (position 16939485)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 17145818
GRCz11 3 17295618
KASP Assay ID:
2259-3235.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCCNNCCAGACTCTTTCTCTTCCTGTKGTGGTAATTGTTCATGGAAGT[C/T]AAGATAACAATGCCACGGCCACCGTTCTATGGGACAATGCCTTTGCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19972
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024832 Nonsense 617 785 15 19
ENSDART00000132256 Nonsense 617 785 17 21
ENSDART00000139763 Nonsense 617 785 16 20
Genomic Location (Zv9):
Chromosome 3 (position 16961991)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 17168324
GRCz11 3 17318124
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGCAAGCTCAGGATATGCTGATGTCCAAACCCAACGGGACCTTCCTGT[T/A]GCGATTCAGCGACTCAGAAATCGGCGGCATCACTATAGCCTGGGTGGCGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link