
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
flt1
- Ensembl ID:
- ENSDARG00000019371
- ZFIN ID:
- ZDB-GENE-050407-1
- Description:
- vascular endothelial growth factor receptor 1 [Source:RefSeq peptide;Acc:NP_001014829]
- Human Orthologue:
- FLT1
- Human Description:
- fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor recep
- Mouse Orthologue:
- Flt1
- Mouse Description:
- FMS-like tyrosine kinase 1 Gene [Source:MGI Symbol;Acc:MGI:95558]
Alleles
There are 8 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa30092 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa1504 | Essential Splice Site | Available for shipment | Available now |
sa15078 | Essential Splice Site | Available for shipment | Available now |
sa301 | Nonsense | F2 line generated | During 2018 |
sa37886 | Nonsense | Available for shipment | Available now |
sa37885 | Nonsense | Available for shipment | Available now |
sa12242 | Essential Splice Site | Available for shipment | Available now |
sa39448 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa30092
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000025621 | Essential Splice Site | 361 | 1272 | 8 | 30 |
ENSDART00000130446 | Essential Splice Site | 361 | 473 | 8 | 11 |
- Genomic Location (Zv9):
- Chromosome 24 (position 22396803)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 21643681 GRCz11 24 21788855 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCCGCCTCACTCCGAAATTAAAGGCTTTCCCTGCACCTGAAATCATCTGG[T/G]AAAAAAAGCTGTAATCTGAAGGGATCAAGAATGATGTTTTTGTTCAAAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1504
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000025621 | Essential Splice Site | 418 | 1272 | 9 | 30 |
ENSDART00000130446 | Essential Splice Site | 418 | 473 | 9 | 11 |
- Genomic Location (Zv9):
- Chromosome 24 (position 22396549)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 21643427 GRCz11 24 21788601 - KASP Assay ID:
- 554-1429.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CAGCAGTACGGRCTTTTCCAGAACCTCACCATCACACTGGTGGTAAATGG[T/G]GAGAGTCTGCTTTCATTAAACTACTTGATTGTGATTGGTTGAAAAAAAAG
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa15078
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000025621 | Essential Splice Site | 507 | 1272 | 11 | 30 |
ENSDART00000130446 | None | 473 | None | 11 |
- Genomic Location (Zv9):
- Chromosome 24 (position 22386305)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 21633183 GRCz11 24 21778357 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCATCTTGACWATCAGCCACAGACAGGAAGTGTTAGAAGGGAAGAATAAG[G/A]TGAGTGTTCCAGTGGGTGGACTGATCATAGGGGACATGCCAAAYGATAMA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa301
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000025621 | Nonsense | 683 | 1272 | 14 | 30 |
ENSDART00000130446 | None | 473 | None | 11 |
- Genomic Location (Zv9):
- Chromosome 24 (position 22376964)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 21623842 GRCz11 24 21769016 - KASP Assay ID:
- 554-3093.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATCACTCTCCACTGCCCTGCTCGGGGAGTGCCACAGCCACACATAACATG[G/A]TATAAGAACCAAAGGAAGCTCCAGCAGGTGTCTGGTGAGACTAGGAAGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37886
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000025621 | Nonsense | 742 | 1272 | 16 | 30 |
ENSDART00000130446 | None | 473 | None | 11 |
- Genomic Location (Zv9):
- Chromosome 24 (position 22374006)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 21620884 GRCz11 24 21766058 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTTTTTTCTTTTGTGACAACACTTATTTATGTGTCCTATAGATTCGTCT[G/T]AATCCCTTTCTCTGGAGATCCCGACCCTAGCATGTACGTGTGTTGTGGCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37885
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000025621 | Nonsense | 805 | 1272 | 17 | 30 |
ENSDART00000130446 | None | 473 | None | 11 |
- Genomic Location (Zv9):
- Chromosome 24 (position 22373732)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 21620610 GRCz11 24 21765784 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGCACCCAGGGGAGGAGCCTCTGGTCGAGCACTGTGATAGGCTACAATA[T/A]GACCCCGCAAAATGGGAGTTTCCACGGGACCGCCTTAAACTGGGTACATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12242
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000025621 | Essential Splice Site | 922 | 1272 | 20 | 30 |
ENSDART00000130446 | None | 473 | None | 11 |
- Genomic Location (Zv9):
- Chromosome 24 (position 22371361)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 21618239 GRCz11 24 21763413 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCTGTCTGCWTACCTCAAGAGTAAACGAGAAGTGTTCCTGTTGAATAGGG[T/C]TAGWCTGTTATTCTGTCTGTAATATCTATCTATCTMTCTATCTMTCTATC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39448
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000025621 | Nonsense | 1239 | 1272 | 30 | 30 |
ENSDART00000130446 | None | 473 | None | 11 |
- Genomic Location (Zv9):
- Chromosome 24 (position 22359084)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 21605962 GRCz11 24 21751136 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTTGACTTCATTTAAGTGTCAGTGTTTTGTGTGTTGCAGGTTTTTCTCC[A/T]GAGGTCAAAGTCAGCCTCGTCTGAGCAGCGCCCCCTGTTGTTCTGATCAA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Cognitive performance: A genome-wide study of common SNPs and CNVs in cognitive performance in the CANTAB. (View Study)
- Coronary heart disease: A genome-wide association study of a coronary artery disease risk variant. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: