zgc:110712

Ensembl ID:
ENSDARG00000019365
ZFIN ID:
ZDB-GENE-050417-50
Description:
hypothetical protein LOC550250 [Source:RefSeq peptide;Acc:NP_001017588]
Human Orthologues:
KRT14, KRT16, KRT20, KRT23
Human Descriptions:
keratin 14 [Source:HGNC Symbol;Acc:6416]
keratin 16 [Source:HGNC Symbol;Acc:6423]
keratin 20 [Source:HGNC Symbol;Acc:20412]
keratin 23 (histone deacetylase inducible) [Source:HGNC Symbol;Acc:6438]
Mouse Orthologues:
Krt14, Krt16, Krt20, Krt23
Mouse Descriptions:
keratin 14 Gene [Source:MGI Symbol;Acc:MGI:96688]
keratin 16 Gene [Source:MGI Symbol;Acc:MGI:96690]
keratin 20 Gene [Source:MGI Symbol;Acc:MGI:1914059]
keratin 23 Gene [Source:MGI Symbol;Acc:MGI:2148866]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21862 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21862
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027447 Essential Splice Site 219 453 None 9
ENSDART00000142208 Essential Splice Site 221 455 None 9

The following transcripts of ENSDARG00000019365 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 11693274)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11588277
GRCz11 11 11571898
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACAACCTTTACATCATGATAAATGATCTTTGAACCTCTTCTTTTCCCC[A/T]GGATCTGCATTTGCTGCGAGAACAGCACAGCGGCTCTGTCAATGTGGAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification of 15 loci influencing height in a Korean population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link