
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:110712
- Ensembl ID:
- ENSDARG00000019365
- ZFIN ID:
- ZDB-GENE-050417-50
- Description:
- hypothetical protein LOC550250 [Source:RefSeq peptide;Acc:NP_001017588]
- Human Orthologues:
- KRT14, KRT16, KRT20, KRT23
- Human Descriptions:
- keratin 14 [Source:HGNC Symbol;Acc:6416]
- keratin 16 [Source:HGNC Symbol;Acc:6423]
- keratin 20 [Source:HGNC Symbol;Acc:20412]
- keratin 23 (histone deacetylase inducible) [Source:HGNC Symbol;Acc:6438]
- Mouse Orthologues:
- Krt14, Krt16, Krt20, Krt23
- Mouse Descriptions:
- keratin 14 Gene [Source:MGI Symbol;Acc:MGI:96688]
- keratin 16 Gene [Source:MGI Symbol;Acc:MGI:96690]
- keratin 20 Gene [Source:MGI Symbol;Acc:MGI:1914059]
- keratin 23 Gene [Source:MGI Symbol;Acc:MGI:2148866]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa21862 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa21862
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000027447 | Essential Splice Site | 219 | 453 | None | 9 |
ENSDART00000142208 | Essential Splice Site | 221 | 455 | None | 9 |
The following transcripts of ENSDARG00000019365 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 11 (position 11693274)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 11588277 GRCz11 11 11571898 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTACAACCTTTACATCATGATAAATGATCTTTGAACCTCTTCTTTTCCCC[A/T]GGATCTGCATTTGCTGCGAGAACAGCACAGCGGCTCTGTCAATGTGGAGA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Height: Identification of 15 loci influencing height in a Korean population. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
- Dermatopathia pigmentosa reticularis
- Epidermolysis bullosa simplex, Dowling-Meara type
- Epidermolysis bullosa simplex, Koebner type
- Epidermolysis bullosa simplex, recessive
- Epidermolysis bullosa simplex, Weber-Cockayne type
- Naegeli-Franceschetti-Jadassohn syndrome
More OMIM information for KRT14
- Pachyonychia congenita, Jadassohn-Lewandowsky type
- Palmoplantar keratoderma, nonepidermolytic, focal
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: