sparc

Ensembl ID:
ENSDARG00000019353
ZFIN ID:
ZDB-GENE-030131-9
Description:
SPARC [Source:RefSeq peptide;Acc:NP_001001942]
Human Orthologue:
SPARC
Human Description:
secreted protein, acidic, cysteine-rich (osteonectin) [Source:HGNC Symbol;Acc:11219]
Mouse Orthologue:
Sparc
Mouse Description:
secreted acidic cysteine rich glycoprotein Gene [Source:MGI Symbol;Acc:MGI:98373]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22481 Essential Splice Site Available for shipment Available now
sa22480 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22481
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039660 Essential Splice Site None 291 1 10
ENSDART00000135627 Essential Splice Site None 237 1 9
ENSDART00000141304   None 157 None 7
ENSDART00000146022 Essential Splice Site None 109 1 7

The following transcripts of ENSDARG00000019353 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 26966309)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 25659511
GRCz11 14 25956756
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTTCACCAGCTGACTTCTCCTCTGGCTTCTCTGTAAGACGGACAGAAG[G/A]TAAGAGCTTTCATTTGCCTCACCTTGTCATTCTCCAAAAACTTGACTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22480
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039660 Essential Splice Site 58 291 None 10
ENSDART00000135627 Essential Splice Site 58 237 None 9
ENSDART00000141304 Essential Splice Site 63 157 None 7
ENSDART00000146022 Essential Splice Site 70 109 None 7

The following transcripts of ENSDARG00000019353 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 26954415)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 25647617
GRCz11 14 25944862
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTAATAATTCTGACTTCAAGTATGCCATTAAAGAATTTTTTTTTCTGCT[A/T]GACCCCTGCCTAAACCATCACTGCAAGAAGGGCAAAGTGTGTGAGGTAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link