zgc:122977

Ensembl ID:
ENSDARG00000019341
ZFIN ID:
ZDB-GENE-051120-147
Description:
Gpc1 protein [Source:RefSeq peptide;Acc:NP_001032450]
Human Orthologue:
GPC1
Human Description:
glypican 1 [Source:HGNC Symbol;Acc:4449]
Mouse Orthologue:
Gpc1
Mouse Description:
glypican 1 Gene [Source:MGI Symbol;Acc:MGI:1194891]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14273 Nonsense Available for shipment Available now
sa13289 Nonsense Available for shipment Available now
sa24116 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14273
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022704 Nonsense 102 554 2 9
ENSDART00000125450 Nonsense 111 563 2 9
Genomic Location (Zv9):
Chromosome 22 (position 15685865)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15513874
GRCz11 22 15540257
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTSAGAGAAGCAGGACGATCYATTCAAGCTTTGCTCAATGCTCAGTAC[A/T]GAACCTTTGACAGTGAGTCANACAGCTCNTTTTTGGGYTTTGAGATCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13289
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022704 Nonsense 147 554 3 9
ENSDART00000125450 Nonsense 156 563 3 9
Genomic Location (Zv9):
Chromosome 22 (position 15686733)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15514742
GRCz11 22 15541125
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TRTATCGACTGAATGCAGGAGTGTTTCGTGACCTCTATGCCGAACTGCAT[C/T]GATATTACAGTGGTGCTTCCCTGAATCTCGAGGAGGCCTTGGATGAGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24116
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022704 Nonsense 506 554 9 9
ENSDART00000125450 Nonsense 515 563 9 9
Genomic Location (Zv9):
Chromosome 22 (position 15693647)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15521656
GRCz11 22 15548039
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGTGGCTCGGGAAGCGGCATGTGTGCGGATCACCTGTGTGTTCGTGGT[C/T]GACCTCCGGTTTTTGGGCCGAAAACGGACAGGCCCAAACTCTATGCCACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link