zgc:63466

Ensembl ID:
ENSDARG00000019311
ZFIN ID:
ZDB-GENE-040426-1125
Description:
hypothetical protein LOC393404 [Source:RefSeq peptide;Acc:NP_956726]
Human Orthologue:
FBXO30
Human Description:
F-box protein 30 [Source:HGNC Symbol;Acc:15600]
Mouse Orthologue:
Fbxo30
Mouse Description:
F-box protein 30 Gene [Source:MGI Symbol;Acc:MGI:1919115]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37587 Nonsense Mutation detected in F1 DNA During 2018
sa37586 Nonsense Mutation detected in F1 DNA During 2018
sa9676 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37587
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013635 Nonsense 363 831 2 3
ENSDART00000126564 Nonsense 363 831 1 2
Genomic Location (Zv9):
Chromosome 23 (position 1588644)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1557019
GRCz11 23 1566126
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGAGTGTTGCCCAGACATGTTAGTGGACCTAGATAGGCAAGGTTTCTG[C/A]AATGGCTCTCATAGTATGGTAGATCACCTAATGGATTCTACTACAAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37586
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013635 Nonsense 413 831 2 3
ENSDART00000126564 Nonsense 413 831 1 2
Genomic Location (Zv9):
Chromosome 23 (position 1588496)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1556871
GRCz11 23 1565978
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTTCCCCATAGACCTGAGATCAGACATGACCAACATGCTTTCTTGATC[C/T]AGGAGGCCTCTGGATCACAAGCCCCATTGCTTCAGCAGCCTGTACACGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9676
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013635 Nonsense 500 831 2 3
ENSDART00000126564 Nonsense 500 831 1 2
Genomic Location (Zv9):
Chromosome 23 (position 1588234)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1556609
GRCz11 23 1565716
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGAAATCCACRCTGCAAAATGGAGGACAAAGCTGTGGATACGTCAGATT[T/G]AGATCAGGAGCCGGTGGATGAYCCTATGGGACTTGGAGAAATTGACTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link