zgc:109967

Ensembl ID:
ENSDARG00000019304
ZFIN ID:
ZDB-GENE-050522-156
Description:
phosphatase and actin regulator 3 [Source:RefSeq peptide;Acc:NP_001018373]
Human Orthologue:
PHACTR3
Human Description:
phosphatase and actin regulator 3 [Source:HGNC Symbol;Acc:15833]
Mouse Orthologue:
Phactr3
Mouse Description:
phosphatase and actin regulator 3 Gene [Source:MGI Symbol;Acc:MGI:1921439]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21827 Nonsense Available for shipment Available now
sa11624 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21827
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050762 Nonsense 43 525 2 13

The following transcripts of ENSDARG00000019304 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 1440017)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 1448157
GRCz11 11 1474745
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTTTGCTGCTGTAGATGTGATGGATCAGCACAGAGCGCTTCATTCT[G/T]GATGTCTGGTGTCCGGGGTCCGAACGCCGCCCATCCGCCGCAACAGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11624
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050762 Nonsense 95 525 3 13

The following transcripts of ENSDARG00000019304 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 1439394)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 1447534
GRCz11 11 1474122
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATATTATCTGATGGCATCYGCAGCGCTGGAGAGGAAAGTGTCCAGCAGG[C/T]AGAATCAYGAGGATSCTGTTAGGAAAGGCCTGGCGGAGGCTGGCATGGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link