
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
cul1a
- Ensembl ID:
- ENSDARG00000019239
- ZFIN ID:
- ZDB-GENE-030131-2603
- Description:
- cullin-1 [Source:RefSeq peptide;Acc:NP_955953]
- Human Orthologue:
- CUL1
- Human Description:
- cullin 1 [Source:HGNC Symbol;Acc:2551]
- Mouse Orthologue:
- Cul1
- Mouse Description:
- cullin 1 Gene [Source:MGI Symbol;Acc:MGI:1349658]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa33046 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa33046
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000013076 | Essential Splice Site | 47 | 777 | None | 23 |
ENSDART00000127623 | Essential Splice Site | 47 | 777 | None | 22 |
The following transcripts of ENSDARG00000019239 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 2 (position 50824998)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 50520530 GRCz11 2 50254760 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGAAAGAAGTTTTCCGGTGTCTTGTTGTGTCCTTAACGTTTTGTTTTTTC[A/T]GTCATGTGTATAATTATTGCACTAGTGTGCATCAGTCGAATCAGGTCCGC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: