zgc:110010

Ensembl ID:
ENSDARG00000019236
ZFIN ID:
ZDB-GENE-050522-116
Description:
glutathione reductase, mitochondrial [Source:RefSeq peptide;Acc:NP_001018390]
Human Orthologue:
GSR
Human Description:
glutathione reductase [Source:HGNC Symbol;Acc:4623]
Mouse Orthologue:
Gsr
Mouse Description:
glutathione reductase Gene [Source:MGI Symbol;Acc:MGI:95804]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15125 Nonsense Available for shipment Available now
sa39011 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa15125
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047050   None 425 None 13
ENSDART00000127479 Nonsense 379 500 11 13
ENSDART00000147521   None 273 None 8

The following transcripts of ENSDARG00000019236 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 40353495)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 38516729
GRCz11 14 38857043
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTTGCTATTGCTGCTGGCAGAAAGCTTGCTCACCGACTGTTTGAGGGC[A/T]AAGCAGACTCCAAAGTCGATTATAATAACATCCCTACAGTAGTGTTCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39011
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047050 Nonsense 355 425 12 13
ENSDART00000127479 Nonsense 430 500 12 13
ENSDART00000147521   None 273 None 8

The following transcripts of ENSDARG00000019236 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 40350240)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 38513474
GRCz11 14 38853788
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAAAGACAAGGTGAAGGTTTACACCACTTCTTTCACCCCCATGTATTA[C/A]GCCATTACCACTCGAAAGAGTCAGTGCATCATGAAGTTGGTGTGCGCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link