spna2

Ensembl ID:
ENSDARG00000019231
ZFIN ID:
ZDB-GENE-051113-60
Description:
spectrin alpha chain, brain [Source:RefSeq peptide;Acc:NP_001091958]
Human Orthologue:
SPTAN1
Human Description:
spectrin, alpha, non-erythrocytic 1 (alpha-fodrin) [Source:HGNC Symbol;Acc:11273]
Mouse Orthologue:
Spna2
Mouse Description:
spectrin alpha 2 Gene [Source:MGI Symbol;Acc:MGI:98386]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5681 Nonsense Available for shipment Available now
sa1515 Nonsense Available for shipment Available now
sa23878 Essential Splice Site Available for shipment Available now
sa23879 Nonsense Available for shipment Available now
sa23880 Nonsense Available for shipment Available now
sa23881 Nonsense Available for shipment Available now
sa45731 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa5681
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102251 Nonsense 20 2480 2 56
ENSDART00000102253   None 475 None 11
ENSDART00000102256   None 543 2 57
ENSDART00000124913 Nonsense 20 443 2 10
ENSDART00000140267   None 179 None 6
ENSDART00000102251 Nonsense 20 2480 2 56
ENSDART00000102253   None 475 None 11
ENSDART00000102256   None 543 2 57
ENSDART00000124913 Nonsense 20 443 2 10
ENSDART00000140267   None 179 None 6

The following transcripts of ENSDARG00000019231 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 11366888)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13068253
GRCz11 21 13165241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGTGGAGTCAAGGTTTTAGAGACGGCAGATGACATCCAAGAGCGCCGA[C/T]AGCAGGTTCTGGACCGGTACCGTCGCTTCAAGGAGCTGTCTGTGGTGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1515
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102251 Nonsense 37 2480 2 56
ENSDART00000102253   None 475 None 11
ENSDART00000102256   None 543 2 57
ENSDART00000124913 Nonsense 37 443 2 10
ENSDART00000140267   None 179 None 6

The following transcripts of ENSDARG00000019231 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 11366939)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13068304
GRCz11 21 13165292
KASP Assay ID:
554-1439.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGGTTCTGGACCGGTACCGTCGCTTCAAGGAGCTGTCTGTGGTGCGC[A/T]GACAGAAACTCGAAGACTCTTACCGGTTCCAGTTCTTCCGTCGGGATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23878
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102251 Essential Splice Site 168 2480 4 56
ENSDART00000102253   None 475 None 11
ENSDART00000102256 Essential Splice Site None 543 4 57
ENSDART00000124913 Essential Splice Site 168 443 4 10
ENSDART00000140267   None 179 None 6

The following transcripts of ENSDARG00000019231 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 11368803)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13070168
GRCz11 21 13167156
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGTACCTCCGTGAGTGTGAGGATGCCCTAGACTGGATCAGTGACAAG[G/A]TAAAAAGCGGCGGTTAGACATGTTCTGTTGTGCAGTAGATAATTTGCGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23879
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102251 Nonsense 1091 2480 23 56
ENSDART00000102253   None 475 None 11
ENSDART00000102256   None 543 23 57
ENSDART00000124913   None 443 None 10
ENSDART00000140267   None 179 None 6

The following transcripts of ENSDARG00000019231 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 11383503)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13084868
GRCz11 21 13181856
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTGCTAGAGTTGGGAGAGAAGAGGAAGGACATGCTGGAGAAGAGCTG[C/A]AAGAAGTTCATGCTTTTCCGTGAGGCGAACGAGCTGCAGCAGTGGATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23880
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102251 Nonsense 1406 2480 32 56
ENSDART00000102253   None 475 None 11
ENSDART00000102256   None 543 32 57
ENSDART00000124913   None 443 None 10
ENSDART00000140267   None 179 None 6

The following transcripts of ENSDARG00000019231 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 11390225)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13091590
GRCz11 21 13188578
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGATCGACGCTCGTGCAGGAACCTTCCTGGCTTTTGAGCAGTTTGGA[C/T]AGCAGCTGCTCGCTCGTGGGCATTACGCAAGCCCTGAGATCAAACAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23881
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102251 Nonsense 1648 2480 38 56
ENSDART00000102253   None 475 None 11
ENSDART00000102256   None 543 38 57
ENSDART00000124913   None 443 None 10
ENSDART00000140267   None 179 None 6

The following transcripts of ENSDARG00000019231 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 11395525)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13096890
GRCz11 21 13193878
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTACATTGTTTTGTTTTCAGGCTCGTCTGAATGCTCTGGACGAGCAGTG[G/A]CAGTTCCTGGTCAACAAGTCTGCTGAGAAGAGTCAGAAACTGAAGGAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45731
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102251 Nonsense 2177 2480 48 56
ENSDART00000102253 Nonsense 151 475 2 11
ENSDART00000102256 Nonsense 219 543 48 57
ENSDART00000124913   None 443 None 10
ENSDART00000140267   None 179 None 6

The following transcripts of ENSDARG00000019231 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 11408031)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13109396
GRCz11 21 13206384
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGATCGGCAGATTAAGAGCTACAACGTGGTGTCCAACCCATACACCTG[G/A]TTCACCATGGAGGCTCTGGAGGAGACCTGGAGTAACCTTCAGAAGATCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link