zgc:136929

Ensembl ID:
ENSDARG00000019213
ZFIN ID:
ZDB-GENE-060421-4235
Description:
C-terminal-binding protein 1 [Source:RefSeq peptide;Acc:NP_001035480]
Human Orthologue:
CTBP1
Human Description:
C-terminal binding protein 1 [Source:HGNC Symbol;Acc:2494]
Mouse Orthologue:
Ctbp1
Mouse Description:
C-terminal binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1201685]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22462 Nonsense Available for shipment Available now
sa38990 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa22462
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059796 Nonsense 155 440 4 9
Genomic Location (Zv9):
Chromosome 14 (position 22185106)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 20886594
GRCz11 14 21183839
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTCTACCGACGCACCACCTGGTTGCACCAGGCTCTCCGGGAAGGCACG[C/T]GAGTCCAGAGTGTGGAACAGATTCGGGAGGTCGCATCTGGAGCAGCCCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38990
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059796 Nonsense 285 440 6 9
Genomic Location (Zv9):
Chromosome 14 (position 22191673)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 20893161
GRCz11 14 21190406
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTTGTGGATGAGAAAGCTCTGGCTCAGGCTCTGAAAGAGGGCAGAATA[C/T]GAGGAGCAGCACTGGACGTCCACGAGACAGAGCCCTTCAGGTGAATAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link