zgc:113159

Ensembl ID:
ENSDARG00000019195
ZFIN ID:
ZDB-GENE-050306-57
Description:
hypothetical protein LOC503773 [Source:RefSeq peptide;Acc:NP_001013369]
Human Orthologue:
C16orf7
Human Description:
chromosome 16 open reading frame 7 [Source:HGNC Symbol;Acc:13526]
Mouse Orthologue:
1300018I17Rik
Mouse Description:
RIKEN cDNA 1300018I17 gene Gene [Source:MGI Symbol;Acc:MGI:1914143]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36596 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36596
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019809 Essential Splice Site 112 493 5 12
ENSDART00000090846 Essential Splice Site 243 598 9 17
ENSDART00000133834 Essential Splice Site 304 659 9 17
ENSDART00000138995 Essential Splice Site 121 232 5 7
ENSDART00000147351 Essential Splice Site 121 502 5 12

The following transcripts of ENSDARG00000019195 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 14234953)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14680371
GRCz11 18 14648883
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCCAAATGATCCTGCACTGGTTTCCGGTCTTATCGCCTGCCTTCTCAG[G/A]TAATTTCATAGTGTTAGATAAATTGTTAGAAGGTAATAAATTTATTCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link