tram1

Ensembl ID:
ENSDARG00000019137
ZFIN ID:
ZDB-GENE-021011-1
Description:
translocating chain-associated membrane protein 1 [Source:RefSeq peptide;Acc:NP_705955]
Human Orthologues:
TRAM1, TRAM1L1
Human Descriptions:
translocation associated membrane protein 1 [Source:HGNC Symbol;Acc:20568]
translocation associated membrane protein 1-like 1 [Source:HGNC Symbol;Acc:28371]
Mouse Orthologues:
Tram1, Tram1l1
Mouse Descriptions:
translocating chain-associating membrane protein 1 Gene [Source:MGI Symbol;Acc:MGI:1919515]
translocation associated membrane protein 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:2443503]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37843 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37843
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004664 Nonsense 326 369 10 11
Genomic Location (Zv9):
Chromosome 24 (position 14135254)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 14086702
GRCz11 24 14231121
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTATGATGTGGAAATTTATCAACTTCCAGTTGCGACGATGGAGAGAA[C/T]AAGCACAGACTCAGACCTTAAAGAAGAAATCATCCTCTTCTAAGAGCAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cardiac Troponin-T levels: Association of genome-wide variation with highly sensitive cardiac troponin-T levels in European Americans and Blacks: a meta-analysis from atherosclerosis risk in communities and cardiovascular health studies. (View Study)
  • Obesity (extreme): Common body mass index-associated variants confer risk of extreme obesity. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link