si:ch211-262l3.1

Ensembl ID:
ENSDARG00000019103
ZFIN IDs:
ZDB-GENE-030131-6279, ZDB-GENE-070705-160
Description:
Jmjd2al protein [Source:UniProtKB/TrEMBL;Acc:Q802U7]
Human Orthologue:
KDM4A
Human Description:
lysine (K)-specific demethylase 4A [Source:HGNC Symbol;Acc:22978]
Mouse Orthologue:
Kdm4a
Mouse Description:
lysine (K)-specific demethylase 4A Gene [Source:MGI Symbol;Acc:MGI:2446210]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32882 Nonsense Mutation detected in F1 DNA During 2018
sa45096 Nonsense Mutation detected in F1 DNA During 2018
sa11870 Essential Splice Site Available for shipment Available now
sa45095 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32882
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024302 Nonsense 107 895 4 19
ENSDART00000109814   None 174 None 4
Genomic Location (Zv9):
Chromosome 2 (position 17310353)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 17817319
GRCz11 2 17488488
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATTGATCGTGACACCATCTCTCCTTTATGTTTAAGGTTTTGCAGTCCT[C/T]GATATGATGATTTTGAAGAACTCGAAAGGAAATATTGGAAAAATGTAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45096
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024302 Nonsense 365 895 9 19
ENSDART00000109814   None 174 None 4
Genomic Location (Zv9):
Chromosome 2 (position 17304615)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 17811775
GRCz11 2 17482944
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGTTTTTAGGTGGAGAGGCTGGTGCTCAAGAACTCCGCATTGAGAAC[C/T]AAAGTAATGAGGGACAAAAAAAGAGGTGAAAAAACACACCCTCTTTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11870
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024302 Essential Splice Site 572 895 11 19
ENSDART00000109814   None 174 None 4
Genomic Location (Zv9):
Chromosome 2 (position 17298903)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 17806063
GRCz11 2 17477232
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTAGACGTGAGGCCAAATACACCAACTCCACCCCCAGACACACCAGAGG[T/C]TGGTAACTGCATGCAGTGTTTGTATTTTATTTTTATATGGGCATTAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45095
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024302 Essential Splice Site 609 895 12 19
ENSDART00000109814   None 174 None 4
Genomic Location (Zv9):
Chromosome 2 (position 17295414)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 17802574
GRCz11 2 17473743
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTTGCCGCGTTTGCATCCTCTGCTCCGAGAGAACTCCAGTGATGACGG[T/A]ATCATCTGCTTTTCCGCATTTCATTTACGGTGATTCCACTGATTGTGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link