
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000019093
- Ensembl ID:
- ENSDARG00000019093
- Human Orthologues:
- C3AR1, C5AR1
- Human Descriptions:
- complement component 3a receptor 1 [Source:HGNC Symbol;Acc:1319]
- complement component 5a receptor 1 [Source:HGNC Symbol;Acc:1338]
- Mouse Orthologues:
- C3ar1, C5ar1, Gpr33
- Mouse Descriptions:
- complement component 3a receptor 1 Gene [Source:MGI Symbol;Acc:MGI:1097680]
- complement component 5a receptor 1 Gene [Source:MGI Symbol;Acc:MGI:88232]
- G protein-coupled receptor 33 Gene [Source:MGI Symbol;Acc:MGI:1277106]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15172 | Nonsense | Available for shipment | Available now |
sa25087 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa15172
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000091926 | Nonsense | 29 | 318 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome 19 (position 11141140)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 10599642 GRCz11 19 10518567 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TMTAAAATCTCAACCGACTTTGAGAAAACGACAGTGGATATGGTCTTTTA[C/A]GCTATCATYGTTCTCCTCGGCACCACCGGGAACTCTGTGGTCATCTGGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa25087
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000091926 | Nonsense | 300 | 318 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 19 (position 11142025)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 10600527 GRCz11 19 10519452 - KASP Assay ID:
- 554-7684.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTGCATTAACCCAATCTTGTACTTCTTCATGGGACTGGATGTTAGTCGA[C/T]GATGCAACCAAAGTTTGTCTGGGATTTTTCATAGAGCACTTATGGAGGAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: