snx12

Ensembl ID:
ENSDARG00000019060
ZFIN ID:
ZDB-GENE-040426-787
Description:
sorting nexin 12 isoform 1 [Source:RefSeq peptide;Acc:NP_957417]
Human Orthologue:
SNX12
Human Description:
sorting nexin 12 [Source:HGNC Symbol;Acc:14976]
Mouse Orthologue:
Snx12
Mouse Description:
sorting nexin 12 Gene [Source:MGI Symbol;Acc:MGI:1919331]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23971 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23971
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003335 Essential Splice Site 55 162 None 4
ENSDART00000126678 Essential Splice Site 55 153 None 4
ENSDART00000133478 Essential Splice Site 55 160 None 6
ENSDART00000140811 Essential Splice Site 55 283 None 5
ENSDART00000147375 Essential Splice Site 55 151 None 6
Genomic Location (Zv9):
Chromosome 21 (position 29215295)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30434539
GRCz11 21 30471234
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATAGGAGTCGGTCGTAATCGCTTCACCACCTACGAAGTCCGGATGAGGG[T/A]AGGCCGAATAACCGTAATTGTGTGTTTGTTCCGGAGAGGCTGCGGCTCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link