smarcd1

Ensembl ID:
ENSDARG00000019004
ZFIN ID:
ZDB-GENE-030131-1835
Description:
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily D member 1 [Sour
Human Orthologue:
SMARCD1
Human Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 [S
Mouse Orthologue:
Smarcd1
Mouse Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 Ge

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32372 Nonsense Available for shipment Available now
sa32371 Nonsense Available for shipment Available now
sa24071 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32372
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003422 Nonsense 8 510 1 13

The following transcripts of ENSDARG00000019004 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 6972141)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 6995469
GRCz11 22 7025315
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTCTGTTTGCGGCTCGCGGAGAAGAAGATGGCGGCGCGGAGTGGTTTT[C/T]AGCCTTCGACACCCGGTGGCGGCGGAGCCCCGATGGGACCCGGGCCGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32371
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003422 Nonsense 235 510 6 13

The following transcripts of ENSDARG00000019004 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 6965297)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 6988625
GRCz11 22 7018471
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATGAAGCCACCAAGCAGAAGAGGAAGTTTTCTTCTTTTTTCAAGTCTT[T/A]AGTGATCGAGTTGGACAAAGACTTGTATGGACCTGACAATCATTTGGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24071
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003422 Nonsense 317 510 8 13

The following transcripts of ENSDARG00000019004 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 6964773)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 6988101
GRCz11 22 7017947
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGATTCACACTCAGACCCGGCCTGTGATCATTCAGGCTTTGTGGCAGTA[T/A]GTGAAGACCCACAAACTCCAGGACCCTCATGAACGAGAGTTCATCAACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link