smc3

Ensembl ID:
ENSDARG00000019000
ZFIN ID:
ZDB-GENE-030131-3196
Description:
structural maintenance of chromosomes protein 3 [Source:RefSeq peptide;Acc:NP_999854]
Human Orthologue:
SMC3
Human Description:
structural maintenance of chromosomes 3 [Source:HGNC Symbol;Acc:2468]
Mouse Orthologue:
Smc3
Mouse Description:
structural maintenace of chromosomes 3 Gene [Source:MGI Symbol;Acc:MGI:1339795]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43874 Essential Splice Site Mutation detected in F1 DNA During 2018
sa11934 Nonsense Available for shipment Available now
sa37546 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43874
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019786 Essential Splice Site 5 1216 1 29
Genomic Location (Zv9):
Chromosome 22 (position 32596227)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 29957357
GRCz11 22 29906552
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTTTCTGAGGAGTGTTTTGTGCATAAACCGCCATGTACATTAAACAGG[T/C]AAGATGCGACTCACGCGTTGCTTGCAACATTATAATTTACGTGGTACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11934
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019786 Nonsense 280 1216 11 29
Genomic Location (Zv9):
Chromosome 22 (position 32581183)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 29942313
GRCz11 22 29891508
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TNNNNNNNNCTCTGTAGGAGACGGAGCRTGTGGTGCGGGAGCTGAAGTCT[C/T]GAATCTCCGCCATGAAGGAGGAGAAGGAACAGCTGAGCGCMGAGCGACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37546
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019786 Nonsense 1151 1216 27 29
Genomic Location (Zv9):
Chromosome 22 (position 32550723)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 29911853
GRCz11 22 29861048
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCTGCTCCATTCTACCTGTTTGATGAAATCGACCAGGCTCTGGACGCT[C/T]AGCATAGAAAAGCAGTGTCAGGTAATCACTAGTGATTGTTGATAACAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link