myst3

Ensembl ID:
ENSDARG00000018907
ZFIN ID:
ZDB-GENE-021022-3
Description:
histone acetyltransferase MYST3 [Source:RefSeq peptide;Acc:NP_001116784]
Human Orthologue:
MYST3
Human Description:
MYST histone acetyltransferase (monocytic leukemia) 3 [Source:HGNC Symbol;Acc:13013]
Mouse Orthologue:
Myst3
Mouse Description:
MYST histone acetyltransferase (monocytic leukemia) 3 Gene [Source:MGI Symbol;Acc:MGI:2442415]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18269 Nonsense Available for shipment Available now
sa45191 Nonsense Mutation detected in F1 DNA During 2018
sa6053 Nonsense Mutation detected in F1 DNA During 2018
sa2235 Nonsense F2 line generated During 2018
sa45190 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa18269
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006622 Nonsense 352 2246 5 16
Genomic Location (Zv9):
Chromosome 5 (position 16118008)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 13913876
GRCz11 5 14414093
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ARGGGAAGAAAGCTCTTACATGACAAAGCAGCACAAATCAAACGGCGATA[C/A]AATGCACCACTGGGGCGACCGAAGGGCAGGTATTTAATGTTTAATTAWCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45191
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006622 Nonsense 486 2246 7 16
Genomic Location (Zv9):
Chromosome 5 (position 16115568)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 13911436
GRCz11 5 14411653
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTTAACTGTCTTTGTGTCTGTTTGCATCACAGACAATCAGGAGTGCT[C/G]AGACAGCTGGCGGGAGGATGAAGACAAGCTGCCAGGACACGAGAATCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6053
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006622 Nonsense 552 2246 8 16
Genomic Location (Zv9):
Chromosome 5 (position 16111437)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 13907305
GRCz11 5 14407522
KASP Assay ID:
554-3845.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTATAGAGTTWGGGAAGTATGAAATTCAGACGTGGTACTCTTCCCCATA[C/G]CCACAGGAGTACAGCAGGTAAGCAACATGATGATAATAATGTTGCAGTYA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2235
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006622 Nonsense 1464 2246 16 16
Genomic Location (Zv9):
Chromosome 5 (position 16101510)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 13897378
GRCz11 5 14397595
KASP Assay ID:
554-3000.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAAAGTGACAGCAGCAGTAGCAGTAAAAGGCGAAAAGGCCAAGACTCT[G/T]AAGATGATGCGGAGGAGCAGGAGGATGAGGAAGATGAGGAACCACCATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45190
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006622 Nonsense 1931 2246 16 16
Genomic Location (Zv9):
Chromosome 5 (position 16100109)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 13895977
GRCz11 5 14396194
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCAAGTGCCAACCAGCAGCAACAAAAAAAGGTCTCGCAACCCCCTCAA[C/T]AACAACAAAACCCTCAACCACAGCCTCCACCCTCTGCTCCACCACCCCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link