zgc:63976

Ensembl ID:
ENSDARG00000018903
ZFIN ID:
ZDB-GENE-040426-2652
Description:
aminoacyl tRNA synthase complex-interacting multifunctional protein 2 [Source:RefSeq peptide;Acc:NP
Human Orthologue:
AIMP2
Human Description:
aminoacyl tRNA synthetase complex-interacting multifunctional protein 2 [Source:HGNC Symbol;Acc:2060
Mouse Orthologue:
Aimp2
Mouse Description:
aminoacyl tRNA synthetase complex-interacting multifunctional protein 2 Gene [Source:MGI Symbol;Acc:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20165 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20165
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009194 Essential Splice Site 114 321 2 4
Genomic Location (Zv9):
Chromosome 3 (position 61541059)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 60879181
GRCz11 3 61111769
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGACGCCGTCCTCAGAGGAACTGCAGATCTGGACGCTCTGCTGGGCAAG[G/A]TGAGCGTTTACAGGCGCCGTCAGTGACAGCTCACCCCAAAAAAAAAAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link