zgc:109736

Ensembl ID:
ENSDARG00000018889
ZFIN IDs:
ZDB-GENE-050706-50, ZDB-GENE-050706-50
Description:
Zgc:109736 [Source:UniProtKB/TrEMBL;Acc:Q4KML1]
Human Orthologue:
RBM26
Human Description:
RNA binding motif protein 26 [Source:HGNC Symbol;Acc:20327]
Mouse Orthologue:
Rbm26
Mouse Description:
RNA binding motif protein 26 Gene [Source:MGI Symbol;Acc:MGI:1921463]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18577 Nonsense Available for shipment Available now
sa31496 Nonsense Available for shipment Available now
sa1169 Nonsense Confirmed mutation in F2 line During 2018
sa40628 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa18577
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066084   None 390 6 23
ENSDART00000114086 Nonsense 152 1009 5 22
Genomic Location (Zv9):
Chromosome 6 (position 4250084)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 4217244
GRCz11 6 4377341
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATTTACAGGAGAGTAGATGACCGCAAGAAAGATGATCGCTCCAGGAAA[C/T]GAGAGTACGATCGTAATCCACCTAGAAGAKWCTCTTACAGGGAACGCYAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31496
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066084 Nonsense 82 390 16 23
ENSDART00000114086 Nonsense 701 1009 15 22
Genomic Location (Zv9):
Chromosome 6 (position 4264425)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCTTTACAGGTCTTATCAACATCTACTGGTTTGACGAAGACTGTCTA[T/G]AACCCAGCTGCTCTGAAAGCTGGCCAGAAGGGGGCGCCATTTAGTGCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1169
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066084 Nonsense 193 390 19 23
ENSDART00000114086 Nonsense 812 1009 18 22
Genomic Location (Zv9):
Chromosome 6 (position 4267142)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 4232703
GRCz11 6 4392800
KASP Assay ID:
554-1079.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAAGCAGTTGTGCATGTGTTTATACTCATGCATATACATTTGCAGGCC[C/T]AGAAGGAGCTCCTGGACACAGAGTTGGATCTTTATAAGAAAATGCAGGCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa40628
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066084 Nonsense 272 390 20 23
ENSDART00000114086 Nonsense 891 1009 19 22
Genomic Location (Zv9):
Chromosome 6 (position 4271503)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 4237103
GRCz11 6 4397200
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATTCGAGGGCGAGGGAGAGGAGCTCCAACCCATGCTGTGGTGGATCAT[C/T]GACCCAGAGCTTTAGAAATCAGCGGTTTCTCCGAGGCCGATCGAGTCGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link