zgc:110175

Ensembl ID:
ENSDARG00000018871
ZFIN ID:
ZDB-GENE-050417-387
Description:
UPF0486 protein C1orf59 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q568P9]
Human Orthologue:
C1orf59
Human Description:
chromosome 1 open reading frame 59 [Source:HGNC Symbol;Acc:26400]
Mouse Orthologue:
4921515J06Rik
Mouse Description:
RIKEN cDNA 4921515J06 gene Gene [Source:MGI Symbol;Acc:MGI:1913965]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26 Essential Splice Site, Missense Available for shipment Available now

Mutation Details

Allele Name:
sa26
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015000 Essential Splice Site 234 402 5 6
ENSDART00000139202 Missense 84 91 2 2
Genomic Location (Zv9):
Chromosome 20 (position 33770478)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33842991
GRCz11 20 33745870
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGGTCCATGAGTAATGCCGAACACTTGGAACCTTCAGTGTACAGACTGG[T/A]GAGGAAAAAAAAAAACTTTCATATGAGATGTACTTTCATTGCCTCTTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link