
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
dgat2
- Ensembl ID:
- ENSDARG00000018846
- ZFIN ID:
- ZDB-GENE-050913-15
- Description:
- Diacylglycerol O-acyltransferase 2 [Source:UniProtKB/Swiss-Prot;Acc:Q4V9F0]
- Human Orthologue:
- DGAT2
- Human Description:
- diacylglycerol O-acyltransferase 2 [Source:HGNC Symbol;Acc:16940]
- Mouse Orthologue:
- Dgat2
- Mouse Description:
- diacylglycerol O-acyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:1915050]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa13945 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa13945
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000066793 | Nonsense | 34 | 361 | 2 | 8 |
ENSDART00000137608 | Nonsense | 34 | 366 | 2 | 8 |
- Genomic Location (Zv9):
- Chromosome 10 (position 33476942)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 32578291 GRCz11 10 32522151 - KASP Assay ID:
- 2260-3412.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCAGCATCCTCTCKGCCTTACACGACCTGCCCACCGTCCCGTGGCTGACC[C/T]GATCCAAAATGGTGAAGCATCTGCAGGTGATCTCCGTGCTGCAGTYTATC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: